Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing dinP gene

Properties
Regulog: LexA - Listeriaceae
Regulator type: Transcription factor
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Phylum: Firmicutes
Built upon 48 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Listeria innocua Clip11262
Position: -38
Score: 5.52928
Sequence: GAATAAGAACGCTTGTTCGTTTTA
Locus tag: lin2082
Name: dinP
Funciton: DNA polymerase IV (EC 2.7.7.7)
dinP -38 5.5 GAATAAGAACGCTTGTTCGTTTTA lin2082
Listeria monocytogenes EGD-e
Position: -38
Score: 5.5507
Sequence: GAATAAGAACGCTTGTTCGTTTTG
Locus tag: lmo1975
Name: dinP
Funciton: DNA polymerase IV (EC 2.7.7.7)
dinP -38 5.6 GAATAAGAACGCTTGTTCGTTTTG lmo1975
Listeria seeligeri serovar 1/2b str. SLCC3954
Position: -39
Score: 5.51056
Sequence: ATTAAGGAACATTTGTTCGTTTTT
Locus tag: lse_1955
Name: dinP
Funciton: DNA polymerase IV (EC 2.7.7.7)
dinP -39 5.5 ATTAAGGAACATTTGTTCGTTTTT lse_1955
Listeria welshimeri serovar 6b str. SLCC5334
Position: -41
Score: 5.25201
Sequence: GATTAAGAACGTTTGTTCGATTTT
Locus tag: lwe1994
Name: dinP
Funciton: DNA polymerase IV (EC 2.7.7.7)
dinP -41 5.3 GATTAAGAACGTTTGTTCGATTTT lwe1994