Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing lmo2675 gene

Regulog: LexA - Listeriaceae
Regulator type: Transcription factor
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Phylum: Firmicutes
Built upon 48 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Listeria innocua Clip11262
Position: -73
Score: 5.52472
Locus tag: lin2822
Name: lmo2675
Funciton: Conserved hypothetical protein
Locus tag: lin2823
Name: uvrX
Funciton: Predicted UV-damage repair protein UvrX
lmo2675-uvrX -73 5.5 AAACAAGAACGTTTGTTCGTATAA lin2822
Listeria monocytogenes EGD-e
Position: -72
Score: 5.63547
Locus tag: lmo2675
Name: lmo2675
Funciton: Conserved hypothetical protein
Locus tag: lmo2676
Name: uvrX
Funciton: Predicted UV-damage repair protein UvrX
lmo2675-uvrX -72 5.6 TAATAAGAACATTTGTTCGTATAA lmo2675
Listeria seeligeri serovar 1/2b str. SLCC3954
Position: -72
Score: 5.24049
Locus tag: lse_2581
Name: lmo2675
Funciton: Conserved hypothetical protein
Locus tag: lse_2582
Name: uvrX
Funciton: Predicted UV-damage repair protein UvrX
lmo2675-uvrX -72 5.2 CAACAAGAACATTCGTTCGTATAA lse_2581
Listeria welshimeri serovar 6b str. SLCC5334
Position: -72
Score: 5.09735
Locus tag: lwe2624
Name: lmo2675
Funciton: Conserved hypothetical protein
Locus tag: lwe2625
Name: uvrX
Funciton: Predicted UV-damage repair protein UvrX
lmo2675-uvrX -72 5.1 AAAATAGAACGCTTGTTCGTATAA lwe2624