Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing addA gene

Regulog: LexA - Listeriaceae
Regulator type: Transcription factor
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Phylum: Firmicutes
Built upon 48 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Listeria innocua Clip11262
Position: -30
Score: 5.75957
Locus tag: lin2369
Name: addB
Funciton: ATP-dependent nuclease, subunit B
Locus tag: lin2368
Name: addA
Funciton: ATP-dependent nuclease, subunit A
Locus tag: lin2367
Name: yisK
Funciton: Conserved hypothetical protein
Locus tag: lin2366
Name: PF07457
Funciton: Conserved hypothetical protein
addB-addA-yisK-PF07457 -30 5.8 AAATAAAAACATATGTTCGGTGGT lin2369
Listeria monocytogenes EGD-e
Position: -30
Score: 5.75957
Locus tag: lmo2268
Name: addB
Funciton: ATP-dependent nuclease, subunit B
Locus tag: lmo2267
Name: addA
Funciton: ATP-dependent nuclease, subunit A
Locus tag: lmo2266
Name: yisK
Funciton: Conserved hypothetical protein
Locus tag: lmo2265
Name: PF07457
Funciton: Conserved hypothetical protein
addB-addA-yisK-PF07457 -30 5.8 AAATAAAAACATATGTTCGGTGGT lmo2268
Listeria seeligeri serovar 1/2b str. SLCC3954
Position: -30
Score: 5.60011
Locus tag: lse_2247
Name: addB
Funciton: ATP-dependent nuclease, subunit B
Locus tag: lse_2246
Name: addA
Funciton: ATP-dependent nuclease, subunit A
Locus tag: lse_2245
Name: yisK
Funciton: Conserved hypothetical protein
Locus tag: lse_2244
Name: PF07457
Funciton: Conserved hypothetical protein
addB-addA-yisK-PF07457 -30 5.6 AAATAAAAACGTATGTTCGGTGGT lse_2247
Listeria welshimeri serovar 6b str. SLCC5334
Position: -30
Score: 5.75957
Locus tag: lwe2283
Name: addB
Funciton: ATP-dependent nuclease, subunit B
Locus tag: lwe2282
Name: addA
Funciton: ATP-dependent nuclease, subunit A
Locus tag: lwe2281
Name: yisK
Funciton: Conserved hypothetical protein
Locus tag: lwe2280
Name: PF07457
Funciton: Conserved hypothetical protein
addB-addA-yisK-PF07457 -30 5.8 AAATAAAAACATATGTTCGGTGGT lwe2283