Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing dnaE gene

Properties
Regulog: LexA - Listeriaceae
Regulator type: Transcription factor
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Phylum: Firmicutes
Built upon 48 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Listeria innocua Clip11262
Position: -75
Score: 5.63719
Sequence: AAACGCGAACACACTTTCTTTTTT
Locus tag: lin1609
Name: dnaE
Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
dnaE -75 5.6 AAACGCGAACACACTTTCTTTTTT lin1609
Listeria monocytogenes EGD-e
Position: -75
Score: 5.81865
Sequence: AAACACGAACACACTTTCTTTTTT
Locus tag: lmo1574
Name: dnaE
Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
dnaE -75 5.8 AAACACGAACACACTTTCTTTTTT lmo1574
Listeria seeligeri serovar 1/2b str. SLCC3954
Position: -75
Score: 5.81865
Sequence: AAACACGAACACACTTTCTTTTTT
Locus tag: lse_1489
Name: dnaE
Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
dnaE -75 5.8 AAACACGAACACACTTTCTTTTTT lse_1489
Listeria welshimeri serovar 6b str. SLCC5334
Position: -75
Score: 5.81865
Sequence: AAACACGAACACACTTTCTTTTTT
Locus tag: lwe1587
Name: dnaE
Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
dnaE -75 5.8 AAACACGAACACACTTTCTTTTTT lwe1587