Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing ligA gene

Regulog: LexA - Listeriaceae
Regulator type: Transcription factor
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Phylum: Firmicutes
Built upon 48 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Listeria innocua Clip11262
Position: -44
Score: 5.83983
Locus tag: lin1871
Name: pcrA
Funciton: ATP-dependent DNA helicase UvrD/PcrA
Locus tag: lin1870
Name: ligA
Funciton: DNA ligase (EC
Locus tag: lin1869
Name: yerH
Funciton: Putative lipoprotein
pcrA-ligA-yerH -44 5.8 AAATAAGAACAAATGTTTGTATGG lin1871
Listeria monocytogenes EGD-e
Position: -44
Score: 5.83983
Locus tag: lmo1759
Name: pcrA
Funciton: ATP-dependent DNA helicase UvrD/PcrA
Locus tag: lmo1758
Name: ligA
Funciton: DNA ligase (EC
Locus tag: lmo1757
Name: yerH
Funciton: Putative lipoprotein
pcrA-ligA-yerH -44 5.8 AAATAAGAACAAATGTTTGTATGG lmo1759
Listeria seeligeri serovar 1/2b str. SLCC3954
Position: -44
Score: 5.83983
Locus tag: lse_1731
Name: pcrA
Funciton: ATP-dependent DNA helicase UvrD/PcrA
Locus tag: lse_1730
Name: ligA
Funciton: DNA ligase (EC
Locus tag: lse_1729
Name: yerH
Funciton: Putative lipoprotein
pcrA-ligA-yerH -44 5.8 AAATAAGAACAAATGTTTGTATGG lse_1731
Listeria welshimeri serovar 6b str. SLCC5334
Position: -38
Score: 5.83983
Locus tag: lwe1776
Name: pcrA
Funciton: ATP-dependent DNA helicase UvrD/PcrA
Locus tag: lwe1775
Name: ligA
Funciton: DNA ligase (EC
Locus tag: lwe1774
Name: yerH
Funciton: Putative lipoprotein
pcrA-ligA-yerH -38 5.8 AAATAAGAACAAATGTTTGTATGG lwe1776