Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing lexA gene

Properties
Regulog: LexA - Listeriaceae
Regulator type: Transcription factor
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Phylum: Firmicutes
Built upon 48 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Listeria innocua Clip11262
Position: -144
Score: 6.0385
Sequence: AAAAAAGAATGTACGTTCGCTTTT
Position: -84
Score: 5.60417
Sequence: AAAAACGAACCTTTGTTTGCATAT
Locus tag: lin1340
Name: lexA
Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
Locus tag: lin1339
Name: guaA
Funciton: Probable GMP synthase
lexA-guaA -144 6 AAAAAAGAATGTACGTTCGCTTTT lin1340
-84 5.6 AAAAACGAACCTTTGTTTGCATAT
Listeria monocytogenes EGD-e
Position: -144
Score: 5.91372
Sequence: CAAAAAGAATGTATGTTCGCTTTT
Position: -84
Score: 5.60417
Sequence: AAAAACGAACCTTTGTTTGCATAT
Locus tag: lmo1302
Name: lexA
Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
Locus tag: lmo1301
Name: guaA
Funciton: Probable GMP synthase
lexA-guaA -144 5.9 CAAAAAGAATGTATGTTCGCTTTT lmo1302
-84 5.6 AAAAACGAACCTTTGTTTGCATAT
Listeria seeligeri serovar 1/2b str. SLCC3954
Position: -142
Score: 5.67401
Sequence: CCAAAAGAATGTATGTTCGCTTTT
Position: -83
Score: 5.60417
Sequence: AAAAACGAACCTTTGTTTGCATAT
Locus tag: lse_1219
Name: lexA
Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
Locus tag: lse_1218
Name: guaA
Funciton: Probable GMP synthase
lexA-guaA -142 5.7 CCAAAAGAATGTATGTTCGCTTTT lse_1219
-83 5.6 AAAAACGAACCTTTGTTTGCATAT
Listeria welshimeri serovar 6b str. SLCC5334
Position: -146
Score: 5.91372
Sequence: CAAAAAGAATGTATGTTCGCTTTT
Position: -84
Score: 5.60417
Sequence: AAAAACGAACCTTTGTTTGCATAT
Locus tag: lwe1317
Name: lexA
Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
Locus tag: lwe1316
Name: guaA
Funciton: Probable GMP synthase
lexA-guaA -146 5.9 CAAAAAGAATGTATGTTCGCTTTT lwe1317
-84 5.6 AAAAACGAACCTTTGTTTGCATAT