Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing recA gene

Properties
Regulog: LexA - Listeriaceae
Regulator type: Transcription factor
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Phylum: Firmicutes
Built upon 48 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Listeria innocua Clip11262
Position: -142
Score: 6.30014
Sequence: AAATACGAATAAATGTTCGCTTTT
Locus tag: lin1435
Name: recA
Funciton: DNA recombinase A
recA -142 6.3 AAATACGAATAAATGTTCGCTTTT lin1435
Listeria monocytogenes EGD-e
Position: -142
Score: 6.30014
Sequence: AAATACGAATAAATGTTCGCTTTT
Locus tag: lmo1398
Name: recA
Funciton: DNA recombinase A
recA -142 6.3 AAATACGAATAAATGTTCGCTTTT lmo1398
Listeria seeligeri serovar 1/2b str. SLCC3954
Position: -143
Score: 6.30014
Sequence: AAATACGAATAAATGTTCGCTTTT
Locus tag: lse_1315
Name: recA
Funciton: DNA recombinase A
recA -143 6.3 AAATACGAATAAATGTTCGCTTTT lse_1315
Listeria welshimeri serovar 6b str. SLCC5334
Position: -143
Score: 6.30014
Sequence: AAATACGAATAAATGTTCGCTTTT
Locus tag: lwe1414
Name: recA
Funciton: DNA recombinase A
recA -143 6.3 AAATACGAATAAATGTTCGCTTTT lwe1414