Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing uvrB gene

Properties
Regulog: LexA - Listeriaceae
Regulator type: Transcription factor
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Phylum: Firmicutes
Built upon 48 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Listeria innocua Clip11262
Position: -163
Score: 6.10283
Sequence: GAATACGAAAATATGTTCGGTTTT
Locus tag: lin2632
Name: uvrB
Funciton: Excinuclease ABC, subunit B
Locus tag: lin2631
Name: uvrA
Funciton: Excinuclease ABC, subunit A
uvrB-uvrA -163 6.1 GAATACGAAAATATGTTCGGTTTT lin2632
Listeria monocytogenes EGD-e
Position: -165
Score: 6.2522
Sequence: AAATGCGAAAATATGTTCGGTTTT
Locus tag: lmo2489
Name: uvrB
Funciton: Excinuclease ABC, subunit B
Locus tag: lmo2488
Name: uvrA
Funciton: Excinuclease ABC, subunit A
uvrB-uvrA -165 6.3 AAATGCGAAAATATGTTCGGTTTT lmo2489
Listeria seeligeri serovar 1/2b str. SLCC3954
Position: -165
Score: 6.43366
Sequence: AAATACGAAAATATGTTCGGTTTT
Locus tag: lse_2389
Name: uvrB
Funciton: Excinuclease ABC, subunit B
Locus tag: lse_2388
Name: uvrA
Funciton: Excinuclease ABC, subunit A
uvrB-uvrA -165 6.4 AAATACGAAAATATGTTCGGTTTT lse_2389
Listeria welshimeri serovar 6b str. SLCC5334
Position: -166
Score: 6.43366
Sequence: AAATACGAAAATATGTTCGGTTTT
Locus tag: lwe2437
Name: uvrB
Funciton: Excinuclease ABC, subunit B
Locus tag: lwe2436
Name: uvrA
Funciton: Excinuclease ABC, subunit A
uvrB-uvrA -166 6.4 AAATACGAAAATATGTTCGGTTTT lwe2437