Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing COG0560 gene

Regulog: PhnR1 - Psychromonadaceae/Aeromonadales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: 2-aminoethylphosphonate utilization
Effector: 2-aminoethylphosphonate
Phylum: Proteobacteria/Gamma
Built upon 8 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Aeromonas hydrophila subsp. hydrophila ATCC 7966
Position: -294
Score: 5.93331
Position: -152
Score: 5.55298
Locus tag: AHA_3983
Name: phnS
Funciton: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
Locus tag: AHA_3984
Name: AHA_3984
Funciton: type I phosphodiesterase
Locus tag: AHA_3985
Name: phnU
Funciton: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1)
Locus tag: AHA_3986
Name: phnV
Funciton: 2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1)
Locus tag: AHA_3987
Name: phnT
Funciton: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
Locus tag: AHA_3988
Name: COG0560
Funciton: Phosphoserine phosphatase (EC
phnS-AHA_3984-phnU-phnV-phnT-COG0560 -294 5.9 TTGCTGGAGTAGTCCAGCTT AHA_3983
Aeromonas salmonicida subsp. salmonicida A449
Position: -167
Score: 5.70632
Position: -26
Score: 5.55298
Locus tag: ASA_4029
Name: phnS
Funciton: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
Locus tag: ASA_4030
Name: AHA_3984
Funciton: type I phosphodiesterase
Locus tag: ASA_4031
Name: phnU
Funciton: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1)
Locus tag: ASA_4032
Name: phnV
Funciton: 2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1)
Locus tag: ASA_4033
Name: phnT
Funciton: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
Locus tag: ASA_4034
Name: COG0560
Funciton: Phosphoserine phosphatase (EC
phnS-AHA_3984-phnU-phnV-phnT-COG0560 -167 5.7 CCGCTGGAGTAGACCAGCGT ASA_4029