Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing phnR1 gene

Properties
Regulog: PhnR1 - Psychromonadaceae/Aeromonadales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: 2-aminoethylphosphonate utilization
Effector: 2-aminoethylphosphonate
Phylum: Proteobacteria/Gamma
Built upon 8 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Aeromonas hydrophila subsp. hydrophila ATCC 7966
Position: -218
Score: 5.55298
Sequence: CCTCTGGACTAGGTCAGTTA
Position: -76
Score: 5.93331
Sequence: AAGCTGGACTACTCCAGCAA
Locus tag: AHA_3982
Name: null
Funciton: 2-aminoethylphosphonate uptake and metabolism regulator, GntR family
AHA_3982 -218 5.6 CCTCTGGACTAGGTCAGTTA AHA_3982
-76 5.9 AAGCTGGACTACTCCAGCAA
Aeromonas salmonicida subsp. salmonicida A449
Position: -223
Score: 5.55298
Sequence: CCTCTGGACTAGGTCAGTTA
Position: -82
Score: 5.70632
Sequence: ACGCTGGTCTACTCCAGCGG
Locus tag: ASA_4028
Name: null
Funciton: 2-aminoethylphosphonate uptake and metabolism regulator, GntR family
ASA_4028 -223 5.6 CCTCTGGACTAGGTCAGTTA ASA_4028
-82 5.7 ACGCTGGTCTACTCCAGCGG