Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing galR gene

Properties
Regulog: GalR - Shewanellaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Galactose utilization
Effector: Galactose
Phylum: Proteobacteria/gamma
Built upon 2 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella woodyi ATCC 51908
Position: -18
Score: 4.89618
Sequence: TAATGTAAACGTTATCTTAT
Locus tag: Swoo_2083
Name: galR
Funciton: galactose utilization repressor, LacI family
galR -18 4.9 TAATGTAAACGTTATCTTAT Swoo_2083