Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing galT2 gene

Regulog: GalR - Shewanellaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Galactose utilization
Effector: Galactose
Phylum: Proteobacteria/gamma
Built upon 2 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella woodyi ATCC 51908
Position: -51
Score: 5.83185
Locus tag: Swoo_2084
Name: galT2
Funciton: Galactose-1-phosphate uridylyltransferase (EC
Locus tag: Swoo_2085
Name: galK2
Funciton: Galactokinase (EC
Locus tag: Swoo_2086
Name: galP2
Funciton: Predicted sodium-dependent galactose transporter
galT2-galK2-galP2 -51 5.8 AAATGGAAACGTTTACATTT Swoo_2084