Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing Atu4690 gene

Regulog: IdnR - Rhizobiales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Idonate utilization
Effector: L-idonate
Phylum: Proteobacteria/Alpha
Built upon 32 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Agrobacterium tumefaciens str. C58 (Cereon)
Position: -245
Score: 5.70868
Position: -83
Score: 6.36887
Locus tag: Atu4687
Name: Atu4687
Funciton: putative ABC transporter, substrate-binding component
Locus tag: Atu4688
Name: Atu4688
Funciton: putative ABC transporter, membrane spanning protein
Locus tag: Atu4689
Name: Atu4689
Funciton: putative ABC transporter, membrane spanning protein
Locus tag: Atu4690
Name: Atu4690
Funciton: putative ABC transporter, ATPase protein
Locus tag: Atu4691
Name: COG1063
Funciton: Threonine dehydrogenase and related Zn-dependent dehydrogenases
Atu4687-Atu4688-Atu4689-Atu4690-COG1063 -245 5.7 CAATGATACCGATAACATGC Atu4687
Azorhizobium caulinodans ORS 571
Position: -96
Score: 5.96004
Locus tag: AZC_2614
Name: idnO
Funciton: Gluconate 5-dehydrogenase (EC
Locus tag: AZC_2615
Name: Atu4687
Funciton: putative ABC transporter, substrate-binding component
Locus tag: AZC_2616
Name: Atu4688
Funciton: putative ABC transporter, membrane spanning protein
Locus tag: AZC_2617
Name: Atu4689
Funciton: putative ABC transporter, membrane spanning protein
Locus tag: AZC_2618
Name: Atu4690
Funciton: putative ABC transporter, ATPase protein
Locus tag: AZC_2619
Name: COG1063
Funciton: Threonine dehydrogenase and related Zn-dependent dehydrogenases
idnO-Atu4687-Atu4688-Atu4689-Atu4690-COG1063 -96 6 TTTTGTTACCGATAACATGC AZC_2614
Rhizobium sp. NGR234
Position: -217
Score: 6.45754
Locus tag: NGR_b22370
Name: Atu4687
Funciton: putative ABC transporter, substrate-binding component
Locus tag: NGR_b22360
Name: Atu4688
Funciton: putative ABC transporter, membrane spanning protein
Locus tag: NGR_b22350
Name: Atu4689
Funciton: putative ABC transporter, membrane spanning protein
Locus tag: NGR_b22340
Name: Atu4690
Funciton: putative ABC transporter, ATPase protein
Atu4687-Atu4688-Atu4689-Atu4690 -217 6.5 ATTTGTTATCGATAACATCT NGR_b22370
Xanthobacter autotrophicus Py2
Position: -83
Score: 5.65488
Locus tag: Xaut_2437
Name: idnO
Funciton: Gluconate 5-dehydrogenase (EC
Locus tag: Xaut_2438
Name: Atu4687
Funciton: putative ABC transporter, substrate-binding component
Locus tag: Xaut_2439
Name: Atu4688
Funciton: putative ABC transporter, membrane spanning protein
Locus tag: Xaut_2440
Name: Atu4689
Funciton: putative ABC transporter, membrane spanning protein
Locus tag: Xaut_2441
Name: Atu4690
Funciton: putative ABC transporter, ATPase protein
idnO-Atu4687-Atu4688-Atu4689-Atu4690 -83 5.7 TCATGTTACCGATATCATGA Xaut_2437