Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing gnl gene

Properties
Regulog: IdnR - Rhizobiales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Idonate utilization
Effector: L-idonate
Phylum: Proteobacteria/Alpha
Built upon 32 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Rhizobium etli CFN 42
Position: -132
Score: 4.85223
Sequence: TAAAGTTATCGCTATCATCG
Position: -37
Score: 6.10209
Sequence: GGATGATATCGATAACAAAT
Locus tag: RHE_PC00140
Name: gnl
Funciton: Gluconolactonase (EC 3.1.1.17)
gnl -132 4.9 TAAAGTTATCGCTATCATCG RHE_PC00140
-37 6.1 GGATGATATCGATAACAAAT
Rhizobium leguminosarum bv. viciae 3841
Position: -177
Score: 4.85223
Sequence: TAAAGTTATCGCTATCATCG
Position: -41
Score: 6.13644
Sequence: AGATGATATCGATAACAATT
Locus tag: pRL100387
Name: gnl
Funciton: Gluconolactonase (EC 3.1.1.17)
gnl -177 4.9 TAAAGTTATCGCTATCATCG pRL100387
-41 6.1 AGATGATATCGATAACAATT