Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing RHE_PC00149 gene

Regulog: IdnR - Rhizobiales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Idonate utilization
Effector: L-idonate
Phylum: Proteobacteria/Alpha
Built upon 32 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Rhizobium etli CFN 42
Position: -57
Score: 6.7736
Locus tag: RHE_PC00147
Name: null
Funciton: Sugar ABC transporter, ATP-binding protein
Locus tag: RHE_PC00148
Name: null
Funciton: Sugar ABC transporter, inner membrane protein
Locus tag: RHE_PC00149
Name: null
Funciton: Sugar ABC transporter, substrate-binding protein
Rhizobium leguminosarum bv. viciae 3841
Position: -55
Score: 6.7736
Locus tag: pRL100394
Name: null
Funciton: Sugar ABC transporter, ATP-binding protein
Locus tag: pRL100395
Name: null
Funciton: Sugar ABC transporter, inner membrane protein
Locus tag: pRL100396
Name: null
Funciton: Sugar ABC transporter, substrate-binding protein
pRL100394-pRL100395-pRL100396 -55 6.8 AAATGTTATCGATAACATAC pRL100394
Rhizobium sp. NGR234
Position: -54
Score: 6.51012
Locus tag: NGR_b22410
Name: null
Funciton: Sugar ABC transporter, ATP-binding protein
Locus tag: NGR_b22400
Name: null
Funciton: Sugar ABC transporter, inner membrane protein
Locus tag: NGR_b22390
Name: null
Funciton: Sugar ABC transporter, substrate-binding protein
NGR_b22410-NGR_b22400-NGR_b22390 -54 6.5 TCATGTTATCGATAACATAA NGR_b22410