Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing idnD gene

Properties
Regulog: IdnR - Rhizobiales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Idonate utilization
Effector: L-idonate
Phylum: Proteobacteria/Alpha
Built upon 32 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Agrobacterium tumefaciens str. C58 (Cereon)
Position: -177
Score: 6.42733
Sequence: ATATGTTACCGATAACATTC
Locus tag: Atu4087
Name: idnD
Funciton: L-idonate 5-dehydrogenase (EC 1.1.1.264)
idnD -177 6.4 ATATGTTACCGATAACATTC Atu4087
Azorhizobium caulinodans ORS 571
Position: -62
Score: 5.96004
Sequence: GCATGTTATCGGTAACAAAA
Locus tag: AZC_2613
Name: idnD
Funciton: L-idonate 5-dehydrogenase (EC 1.1.1.264)
Locus tag: AZC_2612
Name: SSF54909
Funciton: Dimeric alpha-beta barrel
Locus tag: AZC_2611
Name: idnR
Funciton: Predicted transcriptional regulator of L-idonate utilization, LacI family
Locus tag: AZC_2610
Name: gnd
Funciton: 6-phosphogluconate dehydrogenase EC=1.1.1.44
idnD-SSF54909-idnR-gnd -62 6 GCATGTTATCGGTAACAAAA AZC_2613
Rhizobium etli CFN 42
Position: -98
Score: 6.81486
Sequence: ATATGTTATCGATAACATAA
Locus tag: RHE_PC00143
Name: COG1063
Funciton: Threonine dehydrogenase and related Zn-dependent dehydrogenases
Locus tag: RHE_PC00142
Name: idnD
Funciton: L-idonate 5-dehydrogenase (EC 1.1.1.264)
COG1063-idnD -98 6.8 ATATGTTATCGATAACATAA RHE_PC00143
Rhizobium leguminosarum bv. viciae 3841
Position: -68
Score: 6.81486
Sequence: ATATGTTATCGATAACATAA
Locus tag: pRL100390
Name: COG1063
Funciton: Threonine dehydrogenase and related Zn-dependent dehydrogenases
Locus tag: pRL100389
Name: idnD
Funciton: L-idonate 5-dehydrogenase (EC 1.1.1.264)
COG1063-idnD -68 6.8 ATATGTTATCGATAACATAA pRL100390
Rhizobium sp. NGR234
Position: -21
Score: 6.69799
Sequence: TTATGTTATCGATAACATTC
Locus tag: NGR_b22260
Name: COG1063
Funciton: Threonine dehydrogenase and related Zn-dependent dehydrogenases
Locus tag: NGR_b22250
Name: idnD
Funciton: L-idonate 5-dehydrogenase (EC 1.1.1.264)
COG1063-idnD -21 6.7 TTATGTTATCGATAACATTC NGR_b22260
Xanthobacter autotrophicus Py2
Position: -81
Score: 5.65488
Sequence: TCATGATATCGGTAACATGA
Locus tag: Xaut_2436
Name: idnD
Funciton: L-idonate 5-dehydrogenase (EC 1.1.1.264)
Locus tag: Xaut_2435
Name: SSF54909
Funciton: Dimeric alpha-beta barrel
Locus tag: Xaut_2434
Name: idnR
Funciton: Predicted transcriptional regulator of L-idonate utilization, LacI family
Locus tag: Xaut_2433
Name: gnd
Funciton: 6-phosphogluconate dehydrogenase EC=1.1.1.44
idnD-SSF54909-idnR-gnd -81 5.7 TCATGATATCGGTAACATGA Xaut_2436