Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing idnK gene

Properties
Regulog: IdnR - Rhizobiales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Idonate utilization
Effector: L-idonate
Phylum: Proteobacteria/Alpha
Built upon 32 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Rhizobium etli CFN 42
Position: -105
Score: 6.81486
Sequence: TTATGTTATCGATAACATAT
Locus tag: RHE_PC00144
Name: idnO
Funciton: Gluconate 5-dehydrogenase (EC 1.1.1.69)
Locus tag: RHE_PC00145
Name: idnK
Funciton: Gluconokinase (EC 2.7.1.12)
Locus tag: RHE_PC00146
Name: gnd
Funciton: 6-phosphogluconate dehydrogenase EC=1.1.1.44
idnO-idnK-gnd -105 6.8 TTATGTTATCGATAACATAT RHE_PC00144
Rhizobium leguminosarum bv. viciae 3841
Position: -104
Score: 6.81486
Sequence: TTATGTTATCGATAACATAT
Locus tag: pRL100391
Name: idnO
Funciton: Gluconate 5-dehydrogenase (EC 1.1.1.69)
Locus tag: pRL100392
Name: idnK
Funciton: Gluconokinase (EC 2.7.1.12)
Locus tag: pRL100393
Name: gnd
Funciton: 6-phosphogluconate dehydrogenase EC=1.1.1.44
idnO-idnK-gnd -104 6.8 TTATGTTATCGATAACATAT pRL100391
Rhizobium sp. NGR234
Position: -48
Score: 6.69799
Sequence: GAATGTTATCGATAACATAA
Locus tag: NGR_b22270
Name: idnO
Funciton: Gluconate 5-dehydrogenase (EC 1.1.1.69)
Locus tag: NGR_b22280
Name: idnK
Funciton: Gluconokinase (EC 2.7.1.12)
Locus tag: NGR_b22290
Name: gnd
Funciton: 6-phosphogluconate dehydrogenase EC=1.1.1.44
Locus tag: NGR_b22300
Name: SSF54909
Funciton: Dimeric alpha-beta barrel
Locus tag: NGR_b22310
Name: idnR
Funciton: Predicted transcriptional regulator of L-idonate utilization, LacI family
idnO-idnK-gnd-SSF54909-idnR -48 6.7 GAATGTTATCGATAACATAA NGR_b22270