Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing idnR gene

Regulog: IdnR - Rhizobiales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Idonate utilization
Effector: L-idonate
Phylum: Proteobacteria/Alpha
Built upon 32 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Agrobacterium tumefaciens str. C58 (Cereon)
Position: -232
Score: 6.36887
Position: -70
Score: 5.70868
Locus tag: Atu4686
Name: SSF54909
Funciton: Dimeric alpha-beta barrel
Locus tag: Atu4685
Name: idnR
Funciton: Predicted transcriptional regulator of L-idonate utilization, LacI family
SSF54909-idnR -232 6.4 AAATGTTCTCGATAACATTT Atu4686
Azorhizobium caulinodans ORS 571
Position: -62
Score: 5.96004
Locus tag: AZC_2613
Name: idnD
Funciton: L-idonate 5-dehydrogenase (EC
Locus tag: AZC_2612
Name: SSF54909
Funciton: Dimeric alpha-beta barrel
Locus tag: AZC_2611
Name: idnR
Funciton: Predicted transcriptional regulator of L-idonate utilization, LacI family
Locus tag: AZC_2610
Name: gnd
Funciton: 6-phosphogluconate dehydrogenase EC=
idnD-SSF54909-idnR-gnd -62 6 GCATGTTATCGGTAACAAAA AZC_2613
Bradyrhizobium sp. BTAi1
Position: -114
Score: 5.65215
Locus tag: BBta_0778
Name: idnR
Funciton: Predicted transcriptional regulator of L-idonate utilization, LacI family
Rhizobium etli CFN 42
Position: -226
Score: 6.10209
Position: -131
Score: 4.85223
Locus tag: RHE_PC00141
Name: idnR
Funciton: Predicted transcriptional regulator of L-idonate utilization, LacI family
Rhizobium leguminosarum bv. viciae 3841
Position: -268
Score: 6.13644
Position: -132
Score: 4.85223
Locus tag: pRL100388
Name: idnR
Funciton: Predicted transcriptional regulator of L-idonate utilization, LacI family
Rhizobium sp. NGR234
Position: -48
Score: 6.69799
Locus tag: NGR_b22270
Name: idnO
Funciton: Gluconate 5-dehydrogenase (EC
Locus tag: NGR_b22280
Name: idnK
Funciton: Gluconokinase (EC
Locus tag: NGR_b22290
Name: gnd
Funciton: 6-phosphogluconate dehydrogenase EC=
Locus tag: NGR_b22300
Name: SSF54909
Funciton: Dimeric alpha-beta barrel
Locus tag: NGR_b22310
Name: idnR
Funciton: Predicted transcriptional regulator of L-idonate utilization, LacI family
idnO-idnK-gnd-SSF54909-idnR -48 6.7 GAATGTTATCGATAACATAA NGR_b22270
Xanthobacter autotrophicus Py2
Position: -81
Score: 5.65488
Locus tag: Xaut_2436
Name: idnD
Funciton: L-idonate 5-dehydrogenase (EC
Locus tag: Xaut_2435
Name: SSF54909
Funciton: Dimeric alpha-beta barrel
Locus tag: Xaut_2434
Name: idnR
Funciton: Predicted transcriptional regulator of L-idonate utilization, LacI family
Locus tag: Xaut_2433
Name: gnd
Funciton: 6-phosphogluconate dehydrogenase EC=
idnD-SSF54909-idnR-gnd -81 5.7 TCATGATATCGGTAACATGA Xaut_2436