Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing celR gene

Regulog: CelR - Micrococcineae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Cellobiose utilization
Effector: Cellobiose
Phylum: Actinobacteria
Built upon 10 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Arthrobacter aurescens TC1
Position: -115
Score: 4.64947
Position: -59
Score: 4.93141
Locus tag: AAur_0088
Name: cebE
Funciton: Cellobiose specific ABC transporter, substrate-binding protein
Locus tag: AAur_0087
Name: cebF
Funciton: Cellobiose specific ABC transporter, permease protein 1
Locus tag: AAur_0086
Name: cebG
Funciton: Cellobiose specific ABC transporter, permease protein 2
Locus tag: AAur_0085
Name: bglC
Funciton: Beta-glucosidase (EC
Locus tag: AAur_0084
Name: celR
Funciton: Cellobiose utilization transcriptional regulator CelR, LacI family
cebE-cebF-cebG-bglC-celR -115 4.6 GTCAGAGAGCGCTCTCTTGA AAur_0088
Arthrobacter chlorophenolicus A6
Position: -226
Score: 5.89913
Position: -170
Score: 4.86772
Position: -115
Score: 6.03332
Locus tag: Achl_0399
Name: cebE
Funciton: Cellobiose specific ABC transporter, substrate-binding protein
Locus tag: Achl_0400
Name: cebF
Funciton: Cellobiose specific ABC transporter, permease protein 1
Locus tag: Achl_0401
Name: cebG
Funciton: Cellobiose specific ABC transporter, permease protein 2
Locus tag: Achl_0402
Name: bglC
Funciton: Beta-glucosidase (EC
Locus tag: Achl_0403
Name: celR
Funciton: Cellobiose utilization transcriptional regulator CelR, LacI family
cebE-cebF-cebG-bglC-celR -226 5.9 TGGTGGGAGCGCTCCCGTCG Achl_0399
Beutenbergia cavernae DSM 12333
Position: -132
Score: 6.14418
Position: -96
Score: 5.96195
Locus tag: Bcav_2837
Name: cebE
Funciton: Cellobiose specific ABC transporter, substrate-binding protein
Locus tag: Bcav_2838
Name: cebF
Funciton: Cellobiose specific ABC transporter, permease protein 1
Locus tag: Bcav_2839
Name: cebG
Funciton: Cellobiose specific ABC transporter, permease protein 2
Locus tag: Bcav_2840
Name: bglC
Funciton: Beta-glucosidase (EC
Locus tag: Bcav_2841
Name: celR
Funciton: Cellobiose utilization transcriptional regulator CelR, LacI family
cebE-cebF-cebG-bglC-celR -132 6.1 CCGTGAGAGCGCTCCCATGG Bcav_2837
Jonesia denitrificans DSM 20603
Position: -340
Score: 6.08425
Position: -158
Score: 5.33225
Position: -124
Score: 5.60155
Locus tag: Jden_1882
Name: cebE
Funciton: Cellobiose specific ABC transporter, substrate-binding protein
Locus tag: Jden_1881
Name: cebF
Funciton: Cellobiose specific ABC transporter, permease protein 1
Locus tag: Jden_1880
Name: cebG
Funciton: Cellobiose specific ABC transporter, permease protein 2
Locus tag: Jden_1879
Name: bglC
Funciton: Beta-glucosidase (EC
Locus tag: Jden_1878
Name: celR
Funciton: Cellobiose utilization transcriptional regulator CelR, LacI family
cebE-cebF-cebG-bglC-celR -340 6.1 CGGTGGGAACGTTCCCACCG Jden_1882