Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing rbsC gene

Regulog: RbsR - Thermoanaerobacterales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Phylum: Firmicutes
Built upon 4 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Thermoanaerobacter ethanolicus X514
Position: -53
Score: 6.39561
Position: -40
Score: 5.99899
Locus tag: Teth514_0161
Name: rbsR
Funciton: Transcriptional repressor of ribose utilization, LacI famil
Locus tag: Teth514_0162
Name: rbsK
Funciton: Ribokinase (EC
Locus tag: Teth514_0163
Name: rbsD
Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: Teth514_0164
Name: rbsA
Funciton: Ribose ABC transporter, ATP-binding protein (TC 3.A.1.2.1)
Locus tag: Teth514_0165
Name: rbsC
Funciton: Ribose ABC transporter, permease protein 2 (TC 3.A.1.2.1)
Locus tag: Teth514_0166
Name: rbsB
Funciton: Ribose ABC transporter, substrate-binding protein (TC 3.A.1.2.1)
rbsR-rbsK-rbsD-rbsA-rbsC-rbsB -53 6.4 ATAGTTAAGCGTTTTACTAA Teth514_0161
Thermoanaerobacter tengcongensis MB4
Position: -53
Score: 6.39561
Position: -40
Score: 6.21713
Locus tag: TTE0201
Name: rbsR
Funciton: Transcriptional repressor of ribose utilization, LacI famil
Locus tag: TTE0202
Name: rbsK
Funciton: Ribokinase (EC
Locus tag: TTE0203
Name: rbsD
Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: TTE0204
Name: rbsA
Funciton: Ribose ABC transporter, ATP-binding protein (TC 3.A.1.2.1)
Locus tag: TTE0205
Name: rbsC
Funciton: Ribose ABC transporter, permease protein 2 (TC 3.A.1.2.1)
Locus tag: TTE0206
Name: rbsB
Funciton: Ribose ABC transporter, substrate-binding protein (TC 3.A.1.2.1)
rbsR-rbsK-rbsD-rbsA-rbsC-rbsB -53 6.4 ATAGTTAAGCGTTTTACTAA TTE0201