Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing COG2364 gene

Properties
Regulog: PdxR3 - Nocardiaceae
Regulator type: Transcription factor
Regulator family: GntR/MocR
Regulation mode:
Biological process: Pyridoxine/pyridoxal homeostasis
Effector:
Phylum: Actinobacteria
Built upon 16 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Rhodococcus erythropolis PR4
Position: -93
Score: 3.32446
Sequence: ATGCGGGCTTCACGGAAGTGGCAC
Position: -23
Score: 4.66536
Sequence: AGTCCAGTATCGACAACTTGGCTA
Locus tag: RER_23600
Name: COG2364
Funciton: Predicted membrane protein
COG2364 -93 3.3 ATGCGGGCTTCACGGAAGTGGCAC RER_23600
-23 4.7 AGTCCAGTATCGACAACTTGGCTA
Rhodococcus opacus B4
Position: -238
Score: 3.483
Sequence: ACGCCGGCTTCACGGAGGTGGCAC
Position: -160
Score: 3.61312
Sequence: GGTCCAGTAACGCCGACATGGCTA
Locus tag: ROP_65020
Name: COG2364
Funciton: Predicted membrane protein
COG2364 -238 3.5 ACGCCGGCTTCACGGAGGTGGCAC ROP_65020
-160 3.6 GGTCCAGTAACGCCGACATGGCTA
Rhodococcus sp. RHA1
Position: -78
Score: 3.65262
Sequence: ACGCCGGTTTCACCGAGGTGGCTC
Position: -6
Score: 3.92362
Sequence: GGTCCAGTGCCTGCGTGGTGGCTA
Locus tag: RHA1_ro06449
Name: COG2364
Funciton: Predicted membrane protein
COG2364 -78 3.7 ACGCCGGTTTCACCGAGGTGGCTC RHA1_ro06449
-6 3.9 GGTCCAGTGCCTGCGTGGTGGCTA