Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing pdxR3 gene

Properties
Regulog: PdxR3 - Nocardiaceae
Regulator type: Transcription factor
Regulator family: GntR/MocR
Regulation mode:
Biological process: Pyridoxine/pyridoxal homeostasis
Effector:
Phylum: Actinobacteria
Built upon 16 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Nocardia farcinica IFM 10152
Position: -26
Score: 4.91021
Sequence: TAGCCAATCCGCGAATACTGGACT
Locus tag: nfa53660
Name: pdxR3
Funciton: Transcriptional regulator, GntR/MocR family
pdxR3 -26 4.9 TAGCCAATCCGCGAATACTGGACT nfa53660
Rhodococcus erythropolis PR4
Position: -26
Score: 4.66536
Sequence: TAGCCAAGTTGTCGATACTGGACT
Locus tag: RER_14310
Name: pdxR3
Funciton: Transcriptional regulator, GntR/MocR family
pdxR3 -26 4.7 TAGCCAAGTTGTCGATACTGGACT RER_14310
Rhodococcus opacus B4
Position: -239
Score: 3.96268
Sequence: GGTCCAGTCCGGATCTTCTGGACT
Position: -29
Score: 4.12566
Sequence: TAGCCAAGGGGGTGATACTGGACT
Locus tag: ROP_56250
Name: pdxR3
Funciton: Transcriptional regulator, GntR/MocR family
pdxR3 -239 4 GGTCCAGTCCGGATCTTCTGGACT ROP_56250
-29 4.1 TAGCCAAGGGGGTGATACTGGACT
Rhodococcus sp. RHA1
Position: -236
Score: 3.80113
Sequence: AGGCCAGTGCGGATCTTCTGGACT
Position: -26
Score: 3.94143
Sequence: TAGCCAAGAGGTTGATACTGGACT
Locus tag: RHA1_ro05556
Name: pdxR3
Funciton: Transcriptional regulator, GntR/MocR family
pdxR3 -236 3.8 AGGCCAGTGCGGATCTTCTGGACT RHA1_ro05556
-26 3.9 TAGCCAAGAGGTTGATACTGGACT