Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing COG0350 gene

Properties
Regulog: PdxR3 - Nocardiaceae
Regulator type: Transcription factor
Regulator family: GntR/MocR
Regulation mode:
Biological process: Pyridoxine/pyridoxal homeostasis
Effector:
Phylum: Actinobacteria
Built upon 16 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Nocardia farcinica IFM 10152
Position: -67
Score: 5.68084
Sequence: AGTCCAGTTTCGAAAAACTGGACT
Locus tag: nfa53680
Name: COG0350
Funciton: Methylated DNA-protein cysteine methyltransferase
COG0350 -67 5.7 AGTCCAGTTTCGAAAAACTGGACT nfa53680
Rhodococcus opacus B4
Position: -137
Score: 3.96268
Sequence: AGTCCAGAAGATCCGGACTGGACC
Locus tag: ROP_56230
Name: COG0350
Funciton: Methylated DNA-protein cysteine methyltransferase
COG0350 -137 4 AGTCCAGAAGATCCGGACTGGACC ROP_56230