Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing Bcav_0481 gene

Properties
Regulog: AAur_2567 - Micrococcineae
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug resistance; Multidrug efflux
Effector:
Phylum: Actinobacteria
Built upon 9 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Beutenbergia cavernae DSM 12333
Position: -48
Score: 5.85161
Sequence: CATGGTTCACTACTTACGTAATGAACCCCC
Locus tag: Bcav_0486
Name: AAur_2567
Funciton: Transcriptional regulator, GntR family
Locus tag: Bcav_0485
Name: lp_2743
Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: Bcav_0484
Name: lp_2744
Funciton: ABC-type multidrug transport system, permease component
Locus tag: Bcav_0483
Name: lp_2744
Funciton: ABC-type multidrug transport system, permease component
Locus tag: Bcav_0482
Name: null
Funciton: ABC transporter related
Locus tag: Bcav_0481
Name: null
Funciton: ABC-2 type transporter
AAur_2567-lp_2743-lp_2744-lp_2744-Bcav_0482-Bcav_0481 -48 5.9 CATGGTTCACTACTTACGTAATGAACCCCC Bcav_0486