Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing lp_2743 gene

Regulog: AAur_2567 - Micrococcineae
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug resistance; Multidrug efflux
Phylum: Actinobacteria
Built upon 9 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Arthrobacter aurescens TC1
Position: -36
Score: 7.00036
Locus tag: AAur_2567
Name: AAur_2567
Funciton: Transcriptional regulator, GntR family
Locus tag: AAur_2566
Name: lp_2743
Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: AAur_2565
Name: lp_2744
Funciton: ABC-type multidrug transport system, permease component
AAur_2567-lp_2743-lp_2744 -36 7 TATGGTTAGTTACATGAGTAATGAACCAGT AAur_2567
Arthrobacter chlorophenolicus A6
Position: -48
Score: 6.46099
Locus tag: Achl_2889
Name: AAur_2567
Funciton: Transcriptional regulator, GntR family
Locus tag: Achl_2888
Name: lp_2743
Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: Achl_2887
Name: lp_2744
Funciton: ABC-type multidrug transport system, permease component
AAur_2567-lp_2743-lp_2744 -48 6.5 CATGGTTAGTTAGTCAAGTAAGTAACCAAC Achl_2889
Beutenbergia cavernae DSM 12333
Position: -48
Score: 5.85161
Locus tag: Bcav_0486
Name: AAur_2567
Funciton: Transcriptional regulator, GntR family
Locus tag: Bcav_0485
Name: lp_2743
Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: Bcav_0484
Name: lp_2744
Funciton: ABC-type multidrug transport system, permease component
Locus tag: Bcav_0483
Name: lp_2744
Funciton: ABC-type multidrug transport system, permease component
Locus tag: Bcav_0482
Name: null
Funciton: ABC transporter related
Locus tag: Bcav_0481
Name: null
Funciton: ABC-2 type transporter
AAur_2567-lp_2743-lp_2744-lp_2744-Bcav_0482-Bcav_0481 -48 5.9 CATGGTTCACTACTTACGTAATGAACCCCC Bcav_0486
Brachybacterium faecium DSM 4810
Position: -66
Score: 6.4492
Locus tag: Bfae_06980
Name: AAur_2567
Funciton: Transcriptional regulator, GntR family
Locus tag: Bfae_06990
Name: lp_2743
Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: Bfae_07000
Name: lp_2744
Funciton: ABC-type multidrug transport system, permease component
AAur_2567-lp_2743-lp_2744 -66 6.4 CATGGTTCATTAGTGGAGTAATGAACCAAC Bfae_06980
Brevibacterium linens BL2
Position: -45
Score: 6.87521
Locus tag: BlinB01001376
Name: AAur_2567
Funciton: Transcriptional regulator, GntR family
Locus tag: BlinB01001377
Name: lp_2743
Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: BlinB01001378
Name: lp_2744
Funciton: ABC-type multidrug transport system, permease component
AAur_2567-lp_2743-lp_2744 -45 6.9 CATGGTTAGTTAGTTGAGTAACTAACCAAC BlinB01001376
Jonesia denitrificans DSM 20603
Position: -36
Score: 6.61921
Locus tag: Jden_1559
Name: AAur_2567
Funciton: Transcriptional regulator, GntR family
Locus tag: Jden_1558
Name: lp_2743
Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: Jden_1557
Name: lp_2744
Funciton: ABC-type multidrug transport system, permease component
AAur_2567-lp_2743-lp_2744 -36 6.6 ATAGGTTAGTTACATGAGTAATGAACCAGT Jden_1559
Kocuria rhizophila DC2201
Position: -46
Score: 5.99614
Locus tag: KRH_20790
Name: AAur_2567
Funciton: Transcriptional regulator, GntR family
Locus tag: KRH_20780
Name: lp_2743
Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: KRH_20770
Name: lp_2744
Funciton: ABC-type multidrug transport system, permease component
AAur_2567-lp_2743-lp_2744 -46 6 TGTGGTTCCTTAGTAAAGTAATGAACCAAG KRH_20790
Kytococcus sedentarius DSM 20547
Position: -42
Score: 6.8262
Locus tag: Ksed_02920
Name: AAur_2567
Funciton: Transcriptional regulator, GntR family
Locus tag: Ksed_02930
Name: lp_2743
Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: Ksed_02940
Name: lp_2744
Funciton: ABC-type multidrug transport system, permease component
AAur_2567-lp_2743-lp_2744 -42 6.8 AATGGTTAGTTAGTCAAGTAACTAACTAAC Ksed_02920