Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing sgaA gene

Regulog: SgaR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Ascorbate utilization
Effector: Ascorbate-6-phosphate
Phylum: Proteobacteria/gamma
Built upon 34 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Citrobacter koseri ATCC BAA-895
Position: -162
Score: 6.2292
Position: -128
Score: 6.11875
Locus tag: CKO_00489
Name: sgaA
Funciton: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
Locus tag: CKO_00490
Name: sgaB
Funciton: Ascorbate-specific PTS system, EIIB component (EC
Locus tag: CKO_00491
Name: sgaT
Funciton: Ascorbate-specific PTS system, EIIC component
Locus tag: CKO_00492
Name: tktA
Funciton: Transketolase, N-terminal section (EC
Locus tag: CKO_00493
Name: tktB
Funciton: Transketolase, C-terminal section (EC
sgaA-sgaB-sgaT-tktA-tktB -162 6.2 TTTTGATAGCGCTATCACAT CKO_00489
Edwardsiella tarda EIB202
Position: -122
Score: 6.10249
Position: -88
Score: 5.75003
Locus tag: ETAE_3026
Name: sgaA
Funciton: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
Locus tag: ETAE_3027
Name: sgaB
Funciton: Ascorbate-specific PTS system, EIIB component (EC
Locus tag: ETAE_3028
Name: sgaT
Funciton: Ascorbate-specific PTS system, EIIC component
sgaA-sgaB-sgaT -122 6.1 AAATGATAGCGCTATCACGA ETAE_3026
Enterobacter sp. 638
Position: -129
Score: 6.2292
Position: -95
Score: 5.60848
Locus tag: Ent638_2846
Name: sgaA
Funciton: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
Locus tag: Ent638_2845
Name: sgaB
Funciton: Ascorbate-specific PTS system, EIIB component (EC
Locus tag: Ent638_2844
Name: sgaT
Funciton: Ascorbate-specific PTS system, EIIC component
Locus tag: Ent638_2843
Name: tktA
Funciton: Transketolase, N-terminal section (EC
Locus tag: Ent638_2842
Name: tktB
Funciton: Transketolase, C-terminal section (EC
sgaA-sgaB-sgaT-tktA-tktB -129 6.2 ATTTGATAGCGCTATCACAA Ent638_2846
Erwinia carotovora subsp. atroseptica SCRI1043
Position: -91
Score: 5.33971
Locus tag: ECA3773
Name: sgaA
Funciton: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
Locus tag: ECA3774
Name: sgaB
Funciton: Ascorbate-specific PTS system, EIIB component (EC
Locus tag: ECA3775
Name: sgaT
Funciton: Ascorbate-specific PTS system, EIIC component
Locus tag: ECA3776
Name: tal
Funciton: Transaldolase (EC
sgaA-sgaB-sgaT-tal -91 5.3 ATCAGTTAGCGCTACCTTTT ECA3773
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Position: -90
Score: 5.43145
Locus tag: KPN_01747
Name: sgaA
Funciton: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
Locus tag: KPN_01746
Name: sgaB
Funciton: Ascorbate-specific PTS system, EIIB component (EC
Locus tag: KPN_01745
Name: sgaT
Funciton: Ascorbate-specific PTS system, EIIC component
sgaA-sgaB-sgaT -90 5.4 CTTTGTTAGCGCTAACTTTG KPN_01747
Photorhabdus luminescens subsp. laumondii TTO1
Position: -115
Score: 6.26456
Position: -81
Score: 6.16641
Locus tag: plu1979
Name: sgaA
Funciton: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
Locus tag: plu1980
Name: sgaB
Funciton: Ascorbate-specific PTS system, EIIB component (EC
Locus tag: plu1981
Name: sgaT
Funciton: Ascorbate-specific PTS system, EIIC component
sgaA-sgaB-sgaT -115 6.3 AAATGATAGCGCTATCACAA plu1979
Proteus mirabilis HI4320
Position: -109
Score: 5.80258
Position: -75
Score: 5.76389
Locus tag: PMI1777
Name: sgaA
Funciton: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
Locus tag: PMI1776
Name: sgaB
Funciton: Ascorbate-specific PTS system, EIIB component (EC
Locus tag: PMI1775
Name: sgaT
Funciton: Ascorbate-specific PTS system, EIIC component
sgaA-sgaB-sgaT -109 5.8 AAATAATAGCGCTATCACAA PMI1777
Salmonella typhimurium LT2
Position: -131
Score: 6.2292
Position: -97
Score: 5.34693
Locus tag: STM2344
Name: sgaA
Funciton: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
Locus tag: STM2343
Name: sgaB
Funciton: Ascorbate-specific PTS system, EIIB component (EC
Locus tag: STM2342
Name: sgaT
Funciton: Ascorbate-specific PTS system, EIIC component
Locus tag: STM2341
Name: tktA
Funciton: Transketolase, N-terminal section (EC
Locus tag: STM2340
Name: tktB
Funciton: Transketolase, C-terminal section (EC
sgaA-sgaB-sgaT-tktA-tktB -131 6.2 ATTTGATAGCGCTATCACAA STM2344
Yersinia pestis KIM
Position: -128
Score: 6.26456
Position: -107
Score: 5.88118
Position: -94
Score: 5.85977
Locus tag: y1618
Name: sgaA
Funciton: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)