Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing tktB gene

Properties
Regulog: SgaR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Ascorbate utilization
Effector: Ascorbate-6-phosphate
Phylum: Proteobacteria/gamma
Built upon 34 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Citrobacter koseri ATCC BAA-895
Position: -162
Score: 6.2292
Sequence: TTTTGATAGCGCTATCACAT
Position: -128
Score: 6.11875
Sequence: TTTTGATAGCGCTATCTTTG
Locus tag: CKO_00489
Name: sgaA
Funciton: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
Locus tag: CKO_00490
Name: sgaB
Funciton: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
Locus tag: CKO_00491
Name: sgaT
Funciton: Ascorbate-specific PTS system, EIIC component
Locus tag: CKO_00492
Name: tktA
Funciton: Transketolase, N-terminal section (EC 2.2.1.1)
Locus tag: CKO_00493
Name: tktB
Funciton: Transketolase, C-terminal section (EC 2.2.1.1)
sgaA-sgaB-sgaT-tktA-tktB -162 6.2 TTTTGATAGCGCTATCACAT CKO_00489
-128 6.1 TTTTGATAGCGCTATCTTTG
Enterobacter sp. 638
Position: -129
Score: 6.2292
Sequence: ATTTGATAGCGCTATCACAA
Position: -95
Score: 5.60848
Sequence: GATTGGTAGCGCTATCTTTG
Locus tag: Ent638_2846
Name: sgaA
Funciton: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
Locus tag: Ent638_2845
Name: sgaB
Funciton: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
Locus tag: Ent638_2844
Name: sgaT
Funciton: Ascorbate-specific PTS system, EIIC component
Locus tag: Ent638_2843
Name: tktA
Funciton: Transketolase, N-terminal section (EC 2.2.1.1)
Locus tag: Ent638_2842
Name: tktB
Funciton: Transketolase, C-terminal section (EC 2.2.1.1)
sgaA-sgaB-sgaT-tktA-tktB -129 6.2 ATTTGATAGCGCTATCACAA Ent638_2846
-95 5.6 GATTGGTAGCGCTATCTTTG
Salmonella typhimurium LT2
Position: -131
Score: 6.2292
Sequence: ATTTGATAGCGCTATCACAA
Position: -97
Score: 5.34693
Sequence: CGCTGGTAGCGCTATCTTTG
Locus tag: STM2344
Name: sgaA
Funciton: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
Locus tag: STM2343
Name: sgaB
Funciton: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
Locus tag: STM2342
Name: sgaT
Funciton: Ascorbate-specific PTS system, EIIC component
Locus tag: STM2341
Name: tktA
Funciton: Transketolase, N-terminal section (EC 2.2.1.1)
Locus tag: STM2340
Name: tktB
Funciton: Transketolase, C-terminal section (EC 2.2.1.1)
sgaA-sgaB-sgaT-tktA-tktB -131 6.2 ATTTGATAGCGCTATCACAA STM2344
-97 5.3 CGCTGGTAGCGCTATCTTTG