Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing sgaR gene

Properties
Regulog: SgaR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Ascorbate utilization
Effector: Ascorbate-6-phosphate
Phylum: Proteobacteria/gamma
Built upon 34 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Citrobacter koseri ATCC BAA-895
Position: -175
Score: 6.11875
Sequence: CAAAGATAGCGCTATCAAAA
Position: -141
Score: 6.2292
Sequence: ATGTGATAGCGCTATCAAAA
Locus tag: CKO_00488
Name: sgaR
Funciton: Ascorbate utilization transcriptional regulator SgaR, LacI family
sgaR -175 6.1 CAAAGATAGCGCTATCAAAA CKO_00488
-141 6.2 ATGTGATAGCGCTATCAAAA
Edwardsiella tarda EIB202
Position: -242
Score: 5.75003
Sequence: CAATGGTAGCGCTATCTAGT
Position: -208
Score: 6.10249
Sequence: TCGTGATAGCGCTATCATTT
Locus tag: ETAE_3025
Name: sgaR
Funciton: Ascorbate utilization transcriptional regulator SgaR, LacI family
sgaR -242 5.8 CAATGGTAGCGCTATCTAGT ETAE_3025
-208 6.1 TCGTGATAGCGCTATCATTT
Enterobacter sp. 638
Position: -161
Score: 5.60848
Sequence: CAAAGATAGCGCTACCAATC
Position: -127
Score: 6.2292
Sequence: TTGTGATAGCGCTATCAAAT
Locus tag: Ent638_2847
Name: sgaR
Funciton: Ascorbate utilization transcriptional regulator SgaR, LacI family
sgaR -161 5.6 CAAAGATAGCGCTACCAATC Ent638_2847
-127 6.2 TTGTGATAGCGCTATCAAAT
Erwinia carotovora subsp. atroseptica SCRI1043
Position: -228
Score: 5.33971
Sequence: AAAAGGTAGCGCTAACTGAT
Locus tag: ECA3772
Name: sgaR
Funciton: Ascorbate utilization transcriptional regulator SgaR, LacI family
sgaR -228 5.3 AAAAGGTAGCGCTAACTGAT ECA3772
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Position: -138
Score: 5.43145
Sequence: CAAAGTTAGCGCTAACAAAG
Locus tag: KPN_01748
Name: sgaR
Funciton: Ascorbate utilization transcriptional regulator SgaR, LacI family
sgaR -138 5.4 CAAAGTTAGCGCTAACAAAG KPN_01748
Photorhabdus luminescens subsp. laumondii TTO1
Position: -177
Score: 6.16641
Sequence: AAATGATAGCGCTATCTATG
Position: -143
Score: 6.26456
Sequence: TTGTGATAGCGCTATCATTT
Locus tag: plu1978
Name: sgaR
Funciton: Ascorbate utilization transcriptional regulator SgaR, LacI family
sgaR -177 6.2 AAATGATAGCGCTATCTATG plu1978
-143 6.3 TTGTGATAGCGCTATCATTT
Proteus mirabilis HI4320
Position: -171
Score: 5.76389
Sequence: TAATGGTAGCGCTATCTAGA
Position: -137
Score: 5.80258
Sequence: TTGTGATAGCGCTATTATTT
Locus tag: PMI1778
Name: sgaR
Funciton: Ascorbate utilization transcriptional regulator SgaR, LacI family
sgaR -171 5.8 TAATGGTAGCGCTATCTAGA PMI1778
-137 5.8 TTGTGATAGCGCTATTATTT
Salmonella typhimurium LT2
Position: -175
Score: 5.34693
Sequence: CAAAGATAGCGCTACCAGCG
Position: -141
Score: 6.2292
Sequence: TTGTGATAGCGCTATCAAAT
Locus tag: STM2345
Name: sgaR
Funciton: Ascorbate utilization transcriptional regulator SgaR, LacI family
sgaR -175 5.3 CAAAGATAGCGCTACCAGCG STM2345
-141 6.2 TTGTGATAGCGCTATCAAAT
Yersinia pestis KIM
Position: -190
Score: 5.85977
Sequence: AATTGATAGCGCTATCTGGT
Position: -177
Score: 5.88118
Sequence: ATCTGGTAGCGCTATCAAAA
Position: -156
Score: 6.26456
Sequence: TTGTGATAGCGCTATCATTT
Locus tag: y1619
Name: sgaR
Funciton: Ascorbate utilization transcriptional regulator SgaR, LacI family
sgaR -190 5.9 AATTGATAGCGCTATCTGGT y1619
-177 5.9 ATCTGGTAGCGCTATCAAAA
-156 6.3 TTGTGATAGCGCTATCATTT