Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing rbsK gene

Properties
Regulog: RbsR - Streptomycetaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Phylum: Actinobacteria
Built upon 3 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Streptomyces avermitilis MA-4680
Position: -66
Score: 6.45418
Sequence: CGATGTAATCGATTCCACGA
Locus tag: SAV_5320
Name: rbsR
Funciton: Transcriptional repressor of ribose utilization, LacI famil
Locus tag: SAV_5319
Name: rbsA
Funciton: Ribose ABC transporter, ATP-binding protein (TC 3.A.1.2.1)
Locus tag: SAV_5318
Name: rbsBC
Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) / Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: SAV_5317
Name: rbsK
Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: SAV_5316
Name: rbsD
Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
rbsR-rbsA-rbsBC-rbsK-rbsD -66 6.5 CGATGTAATCGATTCCACGA SAV_5320
Streptomyces coelicolor A3(2)
Position: -35
Score: 6.82754
Sequence: CCGTGTAATCGATTCCACGA
Locus tag: SCO2745
Name: rbsR
Funciton: Transcriptional repressor of ribose utilization, LacI famil
Locus tag: SCO2746
Name: rbsA
Funciton: Ribose ABC transporter, ATP-binding protein (TC 3.A.1.2.1)
Locus tag: SCO2747
Name: rbsBC
Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) / Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: SCO2748
Name: rbsK
Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: SCO2749
Name: rbsD
Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
rbsR-rbsA-rbsBC-rbsK-rbsD -35 6.8 CCGTGTAATCGATTCCACGA SCO2745
Streptomyces griseus subsp. griseus NBRC 13350
Position: -96
Score: 6.82754
Sequence: CCGTGTAATCGATTCCATGG
Locus tag: SGR_1097
Name: rbsR
Funciton: Transcriptional repressor of ribose utilization, LacI famil
Locus tag: SGR_1096
Name: rbsA
Funciton: Ribose ABC transporter, ATP-binding protein (TC 3.A.1.2.1)
Locus tag: SGR_1095
Name: rbsBC
Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) / Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: SGR_1094
Name: rbsK
Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: SGR_1093
Name: rbsD
Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
rbsR-rbsA-rbsBC-rbsK-rbsD -96 6.8 CCGTGTAATCGATTCCATGG SGR_1097