Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing bgaR gene

Properties
Regulog: BgaR - Streptomycetaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Galactosides utilization
Effector: Beta-galactosides
Phylum: Actinobacteria
Built upon 8 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Streptomyces avermitilis MA-4680
Position: -92
Score: 6.93314
Sequence: TTATGTTTACGTAAACATCT
Locus tag: SAV_1031
Name: bgaR
Funciton: Putative transcriptional regulator for beta-galactosides utilization, LacI family
bgaR -92 6.9 TTATGTTTACGTAAACATCT SAV_1031
Streptomyces coelicolor A3(2)
Position: -156
Score: 7.09567
Sequence: TGATGTTTACGTAAACATGA
Position: -111
Score: 6.93314
Sequence: TTATGTTTACGTAAACATCT
Locus tag: SCO7411
Name: bgaR
Funciton: Putative transcriptional regulator for beta-galactosides utilization, LacI family
bgaR -156 7.1 TGATGTTTACGTAAACATGA SCO7411
-111 6.9 TTATGTTTACGTAAACATCT
Streptomyces scabiei 87.22
Position: -184
Score: 7.17867
Sequence: GGATGTTTACGTAAACATCC
Locus tag: SCAB_43681
Name: bgaR
Funciton: Putative transcriptional regulator for beta-galactosides utilization, LacI family
bgaR -184 7.2 GGATGTTTACGTAAACATCC SCAB_43681