Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing bgaX gene

Regulog: BgaR - Streptomycetaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Galactosides utilization
Effector: Beta-galactosides
Phylum: Actinobacteria
Built upon 8 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Streptomyces avermitilis MA-4680
Position: -110
Score: 6.93314
Locus tag: SAV_1030
Name: bgaZ
Funciton: Putative beta-galactoside ABC transport system, permease component 1
Locus tag: SAV_1029
Name: bgaY
Funciton: Putative beta-galactoside ABC transport system, permease component 2
Locus tag: SAV_1028
Name: bgaX
Funciton: Putative beta-galactoside ABC transport system, periplasmic component
Locus tag: SAV_1027
Name: bgaB
Funciton: Beta-galactosidase (EC
Locus tag: SAV_1026
Name: gal6
Funciton: Endo-beta-1,6-galactanase
bgaZ-bgaY-bgaX-bgaB-gal6 -110 6.9 AGATGTTTACGTAAACATAA SAV_1030
Streptomyces coelicolor A3(2)
Position: -101
Score: 6.93314
Position: -56
Score: 7.09567
Locus tag: SCO7410
Name: bgaZ
Funciton: Putative beta-galactoside ABC transport system, permease component 1
Locus tag: SCO7409
Name: bgaY
Funciton: Putative beta-galactoside ABC transport system, permease component 2
Locus tag: SCO7408
Name: bgaX
Funciton: Putative beta-galactoside ABC transport system, periplasmic component
Locus tag: SCO7407
Name: bgaB
Funciton: Beta-galactosidase (EC
Locus tag: SCO7406
Name: gal6
Funciton: Endo-beta-1,6-galactanase
bgaZ-bgaY-bgaX-bgaB-gal6 -101 6.9 AGATGTTTACGTAAACATAA SCO7410