Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing kojP gene

Properties
Regulog: KojR - Thermoanaerobacterales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Kojibiose utilization
Effector: Kojibiose
Phylum: Firmicutes
Built upon 11 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Anaerocellum thermophilum DSM 6725
Position: -70
Score: 4.79936
Sequence: TATTGAAAACAATTCGAAAA
Locus tag: Athe_0397
Name: pgmB
Funciton: Beta-phosphoglucomutase (EC 5.4.2.6)
Locus tag: Athe_0398
Name: kojP
Funciton: Kojibiose phosphorylase (EC 2.4.1.230)
pgmB-kojP -70 4.8 TATTGAAAACAATTCGAAAA Athe_0397
Caldicellulosiruptor saccharolyticus DSM 8903
Position: -71
Score: 4.79936
Sequence: TATTGAAAACAATTCGAAAA
Locus tag: Csac_0438
Name: pgmB
Funciton: Beta-phosphoglucomutase (EC 5.4.2.6)
Locus tag: Csac_0439
Name: kojP
Funciton: Kojibiose phosphorylase (EC 2.4.1.230)
pgmB-kojP -71 4.8 TATTGAAAACAATTCGAAAA Csac_0438
Thermoanaerobacter ethanolicus X514
Position: -51
Score: 6.21073
Sequence: TACCCAAAACGTTTCGGATA
Locus tag: Teth514_2202
Name: kojP
Funciton: Kojibiose phosphorylase (EC 2.4.1.230)
Locus tag: Teth514_2201
Name: kojE
Funciton: Kojibiose ABC transporter, substrate-binding protein
Locus tag: Teth514_2200
Name: kojF
Funciton: Kojibiose ABC transporter, permease protein 1
Locus tag: Teth514_2199
Name: kojG
Funciton: Kojibiose ABC transporter, permease protein 2
Locus tag: Teth514_2198
Name: pgmB
Funciton: Beta-phosphoglucomutase (EC 5.4.2.6)
kojP-kojE-kojF-kojG-pgmB -51 6.2 TACCCAAAACGTTTCGGATA Teth514_2202
Thermoanaerobacter italicus Ab9
Position: -49
Score: 6.31471
Sequence: TATCCAAAACGTTTCGGATA
Locus tag: Thit_0754
Name: kojP
Funciton: Kojibiose phosphorylase (EC 2.4.1.230)
Locus tag: Thit_0755
Name: kojE
Funciton: Kojibiose ABC transporter, substrate-binding protein
Locus tag: Thit_0756
Name: kojF
Funciton: Kojibiose ABC transporter, permease protein 1
Locus tag: Thit_0757
Name: kojG
Funciton: Kojibiose ABC transporter, permease protein 2
Locus tag: Thit_0758
Name: pgmB
Funciton: Beta-phosphoglucomutase (EC 5.4.2.6)
kojP-kojE-kojF-kojG-pgmB -49 6.3 TATCCAAAACGTTTCGGATA Thit_0754
Thermoanaerobacter tengcongensis MB4
Position: -45
Score: 6.26502
Sequence: CATCCAAAACGTTTCGGATA
Locus tag: TTE0798
Name: kojP
Funciton: Kojibiose phosphorylase (EC 2.4.1.230)
Locus tag: TTE0799
Name: kojE
Funciton: Kojibiose ABC transporter, substrate-binding protein
Locus tag: TTE0800
Name: kojF
Funciton: Kojibiose ABC transporter, permease protein 1
Locus tag: TTE0801
Name: kojG
Funciton: Kojibiose ABC transporter, permease protein 2
Locus tag: TTE0802
Name: pgmB
Funciton: Beta-phosphoglucomutase (EC 5.4.2.6)
kojP-kojE-kojF-kojG-pgmB -45 6.3 CATCCAAAACGTTTCGGATA TTE0798