Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing kojR gene

Properties
Regulog: KojR - Thermoanaerobacterales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Kojibiose utilization
Effector: Kojibiose
Phylum: Firmicutes
Built upon 11 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Anaerocellum thermophilum DSM 6725
Position: -181
Score: 5.13323
Sequence: TTACGAAAACATTTCGAAAA
Position: -48
Score: 5.60606
Sequence: CATCGAAAACATTTCCGAAA
Locus tag: Athe_0399
Name: kojE
Funciton: Kojibiose ABC transporter, substrate-binding protein
Locus tag: Athe_0400
Name: kojF
Funciton: Kojibiose ABC transporter, permease protein 1
Locus tag: Athe_0401
Name: kojG
Funciton: Kojibiose ABC transporter, permease protein 2
Locus tag: Athe_0402
Name: kojR
Funciton: Kojibiose utilization transcriptional regulator KojR, LacI family
kojE-kojF-kojG-kojR -181 5.1 TTACGAAAACATTTCGAAAA Athe_0399
-48 5.6 CATCGAAAACATTTCCGAAA
Caldicellulosiruptor saccharolyticus DSM 8903
Position: -53
Score: 5.1531
Sequence: TGTCGAAAACATTTCCGAAA
Locus tag: Csac_0440
Name: kojE
Funciton: Kojibiose ABC transporter, substrate-binding protein
Locus tag: Csac_0441
Name: kojF
Funciton: Kojibiose ABC transporter, permease protein 1
Locus tag: Csac_0442
Name: kojG
Funciton: Kojibiose ABC transporter, permease protein 2
Locus tag: Csac_0443
Name: kojR
Funciton: Kojibiose utilization transcriptional regulator KojR, LacI family
kojE-kojF-kojG-kojR -53 5.2 TGTCGAAAACATTTCCGAAA Csac_0440
Thermoanaerobacter ethanolicus X514
Position: -33
Score: 6.65503
Sequence: CAACCAAAACGTTTTGGAAA
Locus tag: Teth514_2203
Name: kojR
Funciton: Kojibiose utilization transcriptional regulator KojR, LacI family
kojR -33 6.7 CAACCAAAACGTTTTGGAAA Teth514_2203
Thermoanaerobacter italicus Ab9
Position: -33
Score: 6.65503
Sequence: CAACCAAAACGTTTTGGAAA
Locus tag: Thit_0753
Name: kojR
Funciton: Kojibiose utilization transcriptional regulator KojR, LacI family
kojR -33 6.7 CAACCAAAACGTTTTGGAAA Thit_0753
Thermoanaerobacter tengcongensis MB4
Position: -31
Score: 6.41169
Sequence: TAACCAAAACGTTTTGGGAA
Locus tag: TTE0797
Name: kojR
Funciton: Kojibiose utilization transcriptional regulator KojR, LacI family
kojR -31 6.4 TAACCAAAACGTTTTGGGAA TTE0797