Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing Jann_1459 gene

Properties
Regulog: Jann_1459 - Rhodobacterales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Phylum: Proteobacteria/Alpha
Built upon 10 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Jannaschia sp. CCS1
Position: -74
Score: 5.40262
Sequence: CTCTGAAATCGATTACATAC
Locus tag: Jann_1459
Name: Jann_1459
Funciton: Transcriptional regulator, LacI family
Jann_1459 -74 5.4 CTCTGAAATCGATTACATAC Jann_1459
Oceanicola batsensis HTCC2597
Position: -84
Score: 5.07918
Sequence: CCTTGAAATCGATTACATCC
Locus tag: OB2597_08889
Name: Jann_1459
Funciton: Transcriptional regulator, LacI family
Jann_1459 -84 5.1 CCTTGAAATCGATTACATCC OB2597_08889
Paracoccus denitrificans PD1222
Position: -62
Score: 4.91066
Sequence: GTCTGCAATCGATTGCAAAC
Locus tag: Pden_4766
Name: Jann_1459
Funciton: Transcriptional regulator, LacI family
Jann_1459 -62 4.9 GTCTGCAATCGATTGCAAAC Pden_4766
Rhodobacter sphaeroides 2.4.1
Position: -93
Score: 5.70327
Sequence: TGATGTAATCGTTTGCAGAG
Position: -61
Score: 4.3248
Sequence: CGCGACAAACGTTTACAACG
Locus tag: RSP_1243
Name: Jann_1459
Funciton: Transcriptional regulator, LacI family
Jann_1459 -93 5.7 TGATGTAATCGTTTGCAGAG RSP_1243
-61 4.3 CGCGACAAACGTTTACAACG