Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing OB2597_08874 gene

Properties
Regulog: Jann_1459 - Rhodobacterales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Phylum: Proteobacteria/Alpha
Built upon 10 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Oceanicola batsensis HTCC2597
Position: -50
Score: 5.07918
Sequence: GGATGTAATCGATTTCAAGG
Locus tag: OB2597_08884
Name: COG1082
Funciton: Sugar phosphate isomerases/epimerases
Locus tag: OB2597_08879
Name: COG0673
Funciton: Predicted dehydrogenases and related proteins
Locus tag: OB2597_08874
Name: null
Funciton: Putative isomerase/epimerase
Locus tag: OB2597_08869
Name: SMb20718
Funciton: Sugar ABC transport system, ATP-binding protein
Locus tag: OB2597_08864
Name: SMb20719
Funciton: SugarABC transport system, inner membrane protein
Locus tag: OB2597_08859
Name: SMb20719
Funciton: SugarABC transport system, inner membrane protein
Locus tag: OB2597_08854
Name: SMb20720
Funciton: Sugar ABC transport system, substrate-binding protein
COG1082-COG0673-OB2597_08874-SMb20718-SMb20719-SMb20719-SMb20720 -50 5.1 GGATGTAATCGATTTCAAGG OB2597_08884