Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing xylB gene

Regulog: GluR - Caulobacterales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Carbohydrate metabolism
Effector: Glucose
Phylum: Proteobacteria/Alpha
Built upon 17 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Caulobacter crescentus CB15
Position: -56
Score: 5.05088
Locus tag: CC1224
Name: gnl
Funciton: Gluconolactonase (EC
Locus tag: CC1225
Name: gfo
Funciton: Glucose--fructose oxidoreductase precursor (EC (GFOR)
Locus tag: CC1226
Name: xylB
Funciton: Endo-1,4-beta-xylanase (EC
gnl-gfo-xylB -56 5.1 CGGTGACATCGCTGTCATGG CC1224
Caulobacter segnis ATCC 21756
Position: -117
Score: 5.43666
Locus tag: Cseg_2660
Name: gnl
Funciton: Gluconolactonase (EC
Locus tag: Cseg_2659
Name: gfo
Funciton: Glucose--fructose oxidoreductase precursor (EC (GFOR)
Locus tag: Cseg_2658
Name: xylB
Funciton: Endo-1,4-beta-xylanase (EC
gnl-gfo-xylB -117 5.4 CCGTGACATCGCTGTCATGA Cseg_2660