Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing pykA gene

Properties
Regulog: GluR - Caulobacterales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Carbohydrate metabolism
Effector: Glucose
Phylum: Proteobacteria/Alpha
Built upon 17 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Caulobacter crescentus CB15
Position: -216
Score: 5.11845
Sequence: TAACGTCAACGTTGTCAGGT
Locus tag: CC2051
Name: pykA
Funciton: Pyruvate kinase (EC 2.7.1.40)
pykA -216 5.1 TAACGTCAACGTTGTCAGGT CC2051
Caulobacter segnis ATCC 21756
Position: -219
Score: 4.63615
Sequence: TTACGTCAACGTTTTCAGGC
Locus tag: Cseg_1380
Name: pykA
Funciton: Pyruvate kinase (EC 2.7.1.40)
pykA -219 4.6 TTACGTCAACGTTTTCAGGC Cseg_1380
Caulobacter sp. K31
Position: -119
Score: 5.73925
Sequence: GCTAGACAACGTTGTCAGGC
Locus tag: Caul_1443
Name: pykA
Funciton: Pyruvate kinase (EC 2.7.1.40)
pykA -119 5.7 GCTAGACAACGTTGTCAGGC Caul_1443