Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing sucA gene

Regulog: GluR - Caulobacterales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Carbohydrate metabolism
Effector: Glucose
Phylum: Proteobacteria/Alpha
Built upon 17 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Caulobacter crescentus CB15
Position: -259
Score: 5.90396
Locus tag: CC0337
Name: sucC
Funciton: Succinyl-CoA ligase [ADP-forming] beta chain (EC
Locus tag: CC0338
Name: sucD
Funciton: Succinyl-CoA ligase [ADP-forming] alpha chain (EC
Locus tag: CC_0339
Name: sucA
Funciton: 2-oxoglutarate dehydrogenase E1 component (EC
Locus tag: CC0340
Name: sucB
Funciton: Dihydrolipoamide succinyltransferase component (E2) of 2-oxoglutarate dehydrogenase complex (EC
sucC-sucD-sucA-sucB -259 5.9 TTATGACAACGTTGCCATTG CC0337
Caulobacter segnis ATCC 21756
Position: -224
Score: 4.42551
Locus tag: Cseg_3807
Name: sucC
Funciton: Succinyl-CoA ligase [ADP-forming] beta chain (EC
Locus tag: Cseg_3806
Name: sucD
Funciton: Succinyl-CoA ligase [ADP-forming] alpha chain (EC
Locus tag: Cseg_3805
Name: sucA
Funciton: 2-oxoglutarate dehydrogenase E1 component (EC
Locus tag: Cseg_3804
Name: sucB
Funciton: Dihydrolipoamide succinyltransferase component (E2) of 2-oxoglutarate dehydrogenase complex (EC
sucC-sucD-sucA-sucB -224 4.4 GATGGAAAGCGTTGTCATCG Cseg_3807
Caulobacter sp. K31
Position: -245
Score: 6.03245
Locus tag: Caul_0229
Name: sucC
Funciton: Succinyl-CoA ligase [ADP-forming] beta chain (EC
Locus tag: Caul_0230
Name: sucD
Funciton: Succinyl-CoA ligase [ADP-forming] alpha chain (EC
Locus tag: Caul_0231
Name: sucA
Funciton: 2-oxoglutarate dehydrogenase E1 component (EC
Locus tag: Caul_0232
Name: sucB
Funciton: Dihydrolipoamide succinyltransferase component (E2) of 2-oxoglutarate dehydrogenase complex (EC
sucC-sucD-sucA-sucB -245 6 CCATGACAAGGCTGTCATTC Caul_0229