Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing ppdK gene

Properties
Regulog: GluR - Caulobacterales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Carbohydrate metabolism
Effector: Glucose
Phylum: Proteobacteria/Alpha
Built upon 17 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Caulobacter crescentus CB15
Position: -198
Score: 5.93332
Sequence: GCCGGACAACGTTGTCATTG
Locus tag: CC1471
Name: ppdK
Funciton: Pyruvate,phosphate dikinase (EC 2.7.9.1)
ppdK -198 5.9 GCCGGACAACGTTGTCATTG CC1471
Caulobacter segnis ATCC 21756
Position: -207
Score: 5.61355
Sequence: TTTGGACAACGTTGTCATTG
Locus tag: Cseg_1949
Name: ppdK
Funciton: Pyruvate,phosphate dikinase (EC 2.7.9.1)
ppdK -207 5.6 TTTGGACAACGTTGTCATTG Cseg_1949
Caulobacter sp. K31
Position: -208
Score: 5.99069
Sequence: CCGAGACAACGTTGTCATTG
Locus tag: Caul_2179
Name: ppdK
Funciton: Pyruvate,phosphate dikinase (EC 2.7.9.1)
ppdK -208 6 CCGAGACAACGTTGTCATTG Caul_2179