Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing glk gene

Regulog: GluR - Caulobacterales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Carbohydrate metabolism
Effector: Glucose
Phylum: Proteobacteria/Alpha
Built upon 17 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Caulobacter crescentus CB15
Position: -73
Score: 6.49159
Locus tag: CC2057
Name: zwf
Funciton: Glucose-6-phosphate 1-dehydrogenase (EC
Locus tag: CC2056
Name: pgl
Funciton: 6-phosphogluconolactonase (EC, eukaryotic type
Locus tag: CC2055
Name: edd
Funciton: Phosphogluconate dehydratase (EC
Locus tag: CC2054
Name: glk
Funciton: Glucokinase (EC
zwf-pgl-edd-glk -73 6.5 TCATGACAACGTTGTCATAG CC2057
Caulobacter segnis ATCC 21756
Position: -34
Score: 6.49159
Locus tag: Cseg_1373
Name: zwf
Funciton: Glucose-6-phosphate 1-dehydrogenase (EC
Locus tag: Cseg_1374
Name: pgl
Funciton: 6-phosphogluconolactonase (EC, eukaryotic type
Locus tag: Cseg_1375
Name: edd
Funciton: Phosphogluconate dehydratase (EC
Locus tag: Cseg_1376
Name: glk
Funciton: Glucokinase (EC
zwf-pgl-edd-glk -34 6.5 TCATGACAACGTTGTCATAG Cseg_1373
Caulobacter sp. K31
Position: -30
Score: 6.49159
Locus tag: Caul_1438
Name: zwf
Funciton: Glucose-6-phosphate 1-dehydrogenase (EC
Locus tag: Caul_1439
Name: pgl
Funciton: 6-phosphogluconolactonase (EC, eukaryotic type
Locus tag: Caul_1440
Name: edd
Funciton: Phosphogluconate dehydratase (EC
Locus tag: Caul_1441
Name: glk
Funciton: Glucokinase (EC
zwf-pgl-edd-glk -30 6.5 TCATGACAACGTTGTCATAG Caul_1438