Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing gluR gene

Properties
Regulog: GluR - Caulobacterales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Carbohydrate metabolism
Effector: Glucose
Phylum: Proteobacteria/Alpha
Built upon 17 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Caulobacter crescentus CB15
Position: -67
Score: 6.29473
Sequence: CCATGACAGCCTTGTCATGG
Locus tag: CC2053
Name: gluR
Funciton: Predicted transcriptional regulator for central carbohydrate metabolism, LacI family
gluR -67 6.3 CCATGACAGCCTTGTCATGG CC2053
Caulobacter segnis ATCC 21756
Position: -66
Score: 6.29473
Sequence: CCATGACAGCCTTGTCATGG
Locus tag: Cseg_1378
Name: gluR
Funciton: Predicted transcriptional regulator for central carbohydrate metabolism, LacI family
gluR -66 6.3 CCATGACAGCCTTGTCATGG Cseg_1378
Caulobacter sp. K31
Position: -68
Score: 5.86817
Sequence: CCTTGACAAGGCTGTCATGC
Locus tag: Caul_1442
Name: gluR
Funciton: Predicted transcriptional regulator for central carbohydrate metabolism, LacI family
gluR -68 5.9 CCTTGACAAGGCTGTCATGC Caul_1442