Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing czcD2 gene

Properties
Regulog: CadR-PbrR - Pseudomonadaceae
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Phylum: Proteobacteria/Gamma
Built upon 14 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Pseudomonas stutzeri A1501
Position: -61
Score: 5.94471
Sequence: ACCTTGTAGTAGCTATAGGGC
Locus tag: PST_3416
Name: czcD2
Funciton: Co/Zn/Cd efflux protein
czcD2 -61 5.9 ACCTTGTAGTAGCTATAGGGC PST_3416