Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing czcD gene

Properties
Regulog: CadR-PbrR - Pseudomonadaceae
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Phylum: Proteobacteria/Gamma
Built upon 14 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Azotobacter vinelandii AvOP
Position: -58
Score: 6.13719
Sequence: ACCCTGAAGCCGCTACAGGGT
Locus tag: Avin_24510
Name: czcD
Funciton: Co/Zn/Cd efflux protein
czcD -58 6.1 ACCCTGAAGCCGCTACAGGGT Avin_24510
Pseudomonas stutzeri A1501
Position: -57
Score: 6.58312
Sequence: ACCCTGTAGTTGCTACAGGGT
Locus tag: PST_1619
Name: czcD
Funciton: Co/Zn/Cd efflux protein
czcD -57 6.6 ACCCTGTAGTTGCTACAGGGT PST_1619