Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing czcR gene

Regulog: CadR-PbrR - Pseudomonadaceae
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Phylum: Proteobacteria/Gamma
Built upon 14 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Pseudomonas entomophila L48
Position: -57
Score: 5.14027
Locus tag: PSEEN4285
Name: czcR
Funciton: DNA-binding heavy metal response regulator
Locus tag: PSEEN4286
Name: PF00512
Funciton: Heavy metal sensor histidine kinase
Pseudomonas fluorescens Pf-5
Position: -71
Score: 5.78683
Locus tag: PFL_3147
Name: czcR
Funciton: DNA-binding heavy metal response regulator
Locus tag: PFL_3148
Name: PF00512
Funciton: Heavy metal sensor histidine kinase
Pseudomonas mendocina ymp
Position: -115
Score: 6.29557
Locus tag: Pmen_1174
Name: czcR
Funciton: DNA-binding heavy metal response regulator
Locus tag: Pmen_1173
Name: PF00512
Funciton: Heavy metal sensor histidine kinase
czcR-PF00512 -115 6.3 ACCCTGTAGTAACTACAGGGA Pmen_1174
Pseudomonas putida KT2440
Position: -56
Score: 5.8445
Locus tag: PP1438
Name: czcR
Funciton: DNA-binding heavy metal response regulator
Locus tag: PP1437
Name: PF00512
Funciton: Heavy metal sensor histidine kinase