Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing cadA gene

Properties
Regulog: CadR-PbrR - Pseudomonadaceae
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Phylum: Proteobacteria/Gamma
Built upon 14 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Azotobacter vinelandii AvOP
Position: -114
Score: 6.25511
Sequence: ACTCTGTAGTGGCTACAGAGT
Locus tag: Avin_18520
Name: cadA
Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
cadA -114 6.3 ACTCTGTAGTGGCTACAGAGT Avin_18520
Pseudomonas aeruginosa PAO1
Position: -60
Score: 6.43039
Sequence: ACTCTGTAGTTGCTACAGGGT
Locus tag: PA3690
Name: cadA
Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
cadA -60 6.4 ACTCTGTAGTTGCTACAGGGT PA3690
Pseudomonas entomophila L48
Position: -163
Score: 6.49822
Sequence: ACCCTATAGTGGCTACAGGGT
Locus tag: PSEEN5232
Name: cadA
Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
cadA -163 6.5 ACCCTATAGTGGCTACAGGGT PSEEN5232
Pseudomonas mendocina ymp
Position: -57
Score: 6.64247
Sequence: ACCCTATAGTGACTACAGGGT
Locus tag: Pmen_4225
Name: cadA
Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
cadA -57 6.6 ACCCTATAGTGACTACAGGGT Pmen_4225
Pseudomonas putida KT2440
Position: -58
Score: 6.49822
Sequence: ACCCTATAGTGGCTACAGGGT
Locus tag: PP5139
Name: cadA
Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
cadA -58 6.5 ACCCTATAGTGGCTACAGGGT PP5139
Pseudomonas stutzeri A1501
Position: -210
Score: 6.21907
Sequence: ACCCTGTAGTGGCTTTAGGGT
Locus tag: PST_0664
Name: cadA
Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
cadA -210 6.2 ACCCTGTAGTGGCTTTAGGGT PST_0664
Pseudomonas syringae pv. tomato str. DC3000
Position: -59
Score: 6.49822
Sequence: ACCCTATAGTGGCTACAGGGT
Locus tag: PSPTO5279
Name: cadA
Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
cadA -59 6.5 ACCCTATAGTGGCTACAGGGT PSPTO5279