Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing Rpic_1752 gene

Properties
Regulog: CadR-PbrR - Ralstonia
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Phylum: Proteobacteria/Beta
Built upon 21 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Ralstonia metallidurans CH34
Position: -115
Score: 5.97091
Sequence: ACCCTGTAGTCACTACAGACT
Locus tag: Rmet_5969
Name: Rpic_1752
Funciton: hypothetical protein
Rpic_1752 -115 6 ACCCTGTAGTCACTACAGACT Rmet_5969
Ralstonia pickettii 12J
Position: -115
Score: 5.97091
Sequence: ACCCTGTAGTCACTACAGACT
Locus tag: Rpic_1752
Name: Rpic_1752
Funciton: hypothetical protein
Rpic_1752 -115 6 ACCCTGTAGTCACTACAGACT Rpic_1752