Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing pbrT gene

Properties
Regulog: CadR-PbrR - Ralstonia
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Phylum: Proteobacteria/Beta
Built upon 21 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Ralstonia metallidurans CH34
Position: -44
Score: 6.1543
Sequence: ACCCTCTAGTTACTATAGAGT
Locus tag: Rmet_5946
Name: pbrR
Funciton: Lead resistance transcriptional regulator, MerR family
Locus tag: Rmet_5945
Name: pbrT
Funciton: Pb(II) uptake protein, ILT family
pbrR-pbrT -44 6.2 ACCCTCTAGTTACTATAGAGT Rmet_5946
Ralstonia pickettii 12J
Position: -43
Score: 6.15292
Sequence: ACTCTATAGCTACTATAGAGT
Locus tag: Rpic_1642
Name: pbrR
Funciton: Lead resistance transcriptional regulator, MerR family
Locus tag: Rpic_1641
Name: pbrT
Funciton: Pb(II) uptake protein, ILT family
pbrR-pbrT -43 6.2 ACTCTATAGCTACTATAGAGT Rpic_1642