Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing pbrD gene

Properties
Regulog: CadR-PbrR - Ralstonia
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Phylum: Proteobacteria/Beta
Built upon 21 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Ralstonia metallidurans CH34
Position: -63
Score: 6.1543
Sequence: ACTCTATAGTAACTAGAGGGT
Locus tag: Rmet_5947
Name: pbrA
Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
Locus tag: Rmet_5948
Name: lspA
Funciton: Lipoprotein signal peptidase (EC 3.4.23.36)
Locus tag: Rmet_5949
Name: pbrD
Funciton: Pb(II) binding protein
pbrA-lspA-pbrD -63 6.2 ACTCTATAGTAACTAGAGGGT Rmet_5947