Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing lspA gene

Properties
Regulog: CadR-PbrR - Ralstonia
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Phylum: Proteobacteria/Beta
Built upon 21 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Ralstonia metallidurans CH34
Position: -63
Score: 6.1543
Sequence: ACTCTATAGTAACTAGAGGGT
Locus tag: pMOL30_091
Name: pbrA
Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
Locus tag: pMOL30_090
Name: lspA
Funciton: Lipoprotein signal peptidase (EC 3.4.23.36)
pbrA-lspA -63 6.2 ACTCTATAGTAACTAGAGGGT pMOL30_091
Ralstonia pickettii 12J
Position: -63
Score: 6.15292
Sequence: ACTCTATAGTAGCTATAGAGT
Locus tag: Rpic_1815
Name: pbrA
Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
Locus tag: Rpic_1814
Name: lspA
Funciton: Lipoprotein signal peptidase (EC 3.4.23.36)
pbrA-lspA -63 6.2 ACTCTATAGTAGCTATAGAGT Rpic_1815