Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Orthologous regulated operons containing cadR gene

Properties
Regulog: CadR-PbrR - Ralstonia
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Phylum: Proteobacteria/Beta
Built upon 21 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Cupriavidus taiwanensis
Position: -39
Score: 6.12231
Sequence: ACCCTGTAGTCGTTACAGGGT
Locus tag: RALTA_A3062
Name: cadR
Funciton: Cadmium resistance transcriptional regulator, MerR family
cadR -39 6.1 ACCCTGTAGTCGTTACAGGGT RALTA_A3062
Ralstonia eutropha H16
Position: -42
Score: 6.14485
Sequence: ACCCTGTAGTAGTTACAGGGT
Locus tag: H16_A3607
Name: cadR
Funciton: Cadmium resistance transcriptional regulator, MerR family
cadR -42 6.1 ACCCTGTAGTAGTTACAGGGT H16_A3607
Ralstonia eutropha JMP134
Position: -31
Score: 5.68202
Sequence: ACCCCGTAGTCACTACAGAGA
Locus tag: Reut_A3299
Name: cadR
Funciton: Cadmium resistance transcriptional regulator, MerR family
cadR -31 5.7 ACCCCGTAGTCACTACAGAGA Reut_A3299
Ralstonia metallidurans CH34
Position: -30
Score: 5.8573
Sequence: ACCCTGTAATTACTACAGGGA
Locus tag: Rmet_3456
Name: cadR
Funciton: Cadmium resistance transcriptional regulator, MerR family
cadR -30 5.9 ACCCTGTAATTACTACAGGGA Rmet_3456